Document Type : Original article
Introduction
Gut microbiota have been known to have a complex interaction with both the development and treatment of different type of cancers (1). Recent studies have highlighted the significant role of gut microbiota in the modulation of immune responses and its potential influence on the development and progression of Papillary Thyroid Cancer (PTC) (2,3). The gut microbiome can also impact the efficacy of iodine therapy and may alter the tumor environment, affecting tumor growth and metastasis (4,5).
On the other hand, iodine therapy, particularly in the context of Radioactive Iodine (RAI) treatment for patients with PTC, has been shown to influence gut microbiota (6). Research suggests that iodine therapy through the alteration in thyroid function can lead to changes in the microbial composition of gut. This shift may be attributed to the potential impact of thyroid hormones on gut motility and mucosal immunity, which can affect microbial balance (7-9). Additionally, iodine treatment may contribute to an increase in certain bacterial populations while decreasing others, potentially resulting in dysbiosis (10). The relationship between thyroid hormones and gut microbiota is bidirectional and complex. Some studies suggest that hypothyroidism can cause changes in gut microbiota (11,12). Gut microbiota plays a crucial role in regulating the thyroid function as well. Composition of gut microbiota can affect the thyroid function through the alteration in the absorption of trace elements like selenium and iodine, impairment in the conversion of T4 to T3, and modulation of the immune system (13). Analyzing the composition and diversity of gut microbiota in patients with PTC, both before and after iodine therapy, could provide insights into how microbial populations influence cancer progression and treatment outcomes. Considering the potential role of Lactobacillus and Bifidobacterium in decreasing the risk of thyroid cancer, this study was conducted to evaluate the changes in Lactobacillus and Bifidobacterium loads in a population of Iranian people with PTC before and following RAI therapy, compared to healthy individuals.
Materials and Methods
Study participants and sample collection
This longitudinal cohort study included 28 healthy individuals and 30 PTC patients referred for RAI therapy. The inclusion criteria were: being candidate for RAI therapy, age less than 55 years, lack of known metastasis, not using antibiotics, probiotics, or prebiotics within two weeks before the initiation of RAI therapy, and two months after receiving RAI therapy. The two time points for collecting stool samples (at two weeks and two months after RAI therapy) were chosen based on half-life of RAI (8 days) and the time required for complete removal of RAI (approximately 32 days) (14). Informed consent was obtained from the participants; and the study protocol was approved by the ethical committee at Iran University of Medical Sciences (IR.IUMS.REC.1398.1413).
DNA extraction
200 mg of stool samples from both patients and healthy individuals were used to extract total metagenomics DNA using the QIAamp DNA stool Mini Kit (Qiagen, Retsch GmbH, Hannover, Germany), following the instructions provided in the kit manual. The quality of isolated DNA was evaluated using a Nanodrop spectrophotometer (MAESTRO-Gene). Isolated DNA was then stored at 4°C until further processing.
Primers used in quantitative real-time PCR (qPCR)
The specific primers for quantitative assays were based on the 16SrRNA sequence of Lactobacillus and Bifidobacterium species obtained from our previous study and those conducted by Matsuki et al (15,16), which are shown in table 1. The quantitative real-time PCR was performed in the ABI StepOne PlusTM real-time PCR instrument (Applied Biosystems, USA), as follows master mix reaction in total volume of 20 μl, which included 12.5 μl of Add SYBR Green master mix (Addbio, Korea), 1 μM for each primer in final concentration and 50 ng metagenomics DNA. The amplification program consisted of an initial denaturation for 10 min at 95ºC, followed by 40 cycles of 15 s denaturation at 95ºC, annealing at 60°C for 30 s, and extension at 72°C for 30 s.
Standard curve
The standard curve of the bacteria abundance against DNA concentration was prepared using 10 different standard strain concentrations (101 to 1010 CFU/ml). The qPCR was carried out in duplicate using extracted DNA from standard strain Lactobacillus acidophilus ATCC 4356 and Bifidobacterium bifidum ATCC 29521. The mean cycle threshold (Ct) values are used for the standard curve. The Ct value of extracted metagenomics DNA was compared with the standard curve that allowed us to determine the bacterial load (CFU/ml) in finally.
Statistical analysis
The data were analyzed using the IBM SPSS version 20.0 software (IBM Corp., Armonk, NY, USA) and all quantitative results are presented as mean ± SD. The distribution of data was assessed using the Shapiro–Wilk test, and based on the results, the student’s t-test was used for the comparison of bacterial load between study groups at different timepoints. Additionally, repeated measures analysis of variance (ANOVA) test was used to analyze the changes in bacterial load in the patient group. Significant results were determined and reported based on p values equal to or smaller than 0.05.
Results
Clinical characteristics of the participants
A total of 90 stool samples from the same 30 patients with PTC were collected at one day before RAI therapy as well as two weeks and two months following RAI therapy. Moreover, 28 stool samples were collected from 28 healthy age-sex matched individuals. All participants were women. The mean age of the PTC patients was 39.13 (8.88) years and that of the healthy individuals was 35.85 (8.44) years (p=0.156). All the PTC patients received RAI with dose of 100 mCi (56%) or 150 mCi (44%).
Microbial load in PTC patients before and following RAI therapy compared to the healthy individuals
Before RAI therapy and at two weeks after RAI therapy, the abundance of Lactobacillus was significantly lower in PTC patients compared to the healthy individuals (3.20 vs. 4.71 copies/gr stool, p=0.023) and (3.12 vs. 4.71 copies/gr stool, p=0.009). However, there was no significant difference in the load of Lactobacillus between the two groups, at two months after RAI therapy (4.79 vs. 4.71 copies/gr stool, p=0.906) (Table 2).
However, there was no significant difference in the load of Bifidobacterium between PTC patients and healthy individuals before and at two time points after RAI therapy (Table 3).
Alteration in microbial load in PTC patients before and following RAI therapy
Lactobacillus load increased significantly over the three time points, from 2.42 copies/gr stool before RAI therapy to 3.80 copies/gr stool at two weeks, and 5.27 copies/gr stool after RAI therapy (p=0.014). There was no significant change in the load of Bifidobacterium before RAI therapy and at the two time points after RAI therapy (Table 4).
Table 1. Primers used in Real-Time PCR to identify the desired bacteria
|
Target bacteria |
Primer |
Oligonucleotide sequences (5ʹ-3ʹ) |
Size (bp) |
Product size (bp) |
|
Bifidobacterium group |
primer F |
CTCCTGGAAACGGGTGG |
17 |
549 |
|
primer R |
GGTGTTCTTCCCGATATCTACA |
22 |
||
|
Lactobacillus group |
primer F |
GTCTGATGTGAAAGCCTTCG |
20 |
204 |
|
primer R |
CCAGGGTATCTAATCCTGTTCG |
22 |
Table 2. Lactobacillus count before and after Iodine therapy in PTC patients compared to healthy individuals*
|
Time point |
PTC patients |
Healthy individuals |
p-value |
|
Before Iodine therapy |
3.20±2.44 |
4.71±2.13 |
0.023 |
|
Two weeks after Iodine therapy |
3.12±1.97 |
4.71±2.13 |
0.009 |
|
Two months after Iodine therapy |
4.79±2.88 |
4.71±2.13 |
0.906 |
* copies/gr of stool; PTC: Papillary Thyroid Cancer.
Table 3. Bifidobacterium count before and after Iodine therapy in PTC patients compared to healthy individuals*
|
Time point |
PTC patients |
Healthy individuals |
p-value |
|
Before Iodine therapy |
6.80±1.09 |
7.15±0.82 |
0.187 |
|
Two weeks after Iodine therapy |
6.79±1.05 |
7.15±0.82 |
0.199 |
|
Two months after Iodine therapy |
7.09±1.26 |
7.15±0.82 |
0.838 |
*copies/gr of stool; PTC: Papillary Thyroid Cancer.
Table 4. Changes in the load of Lactobacillus and Bifidobacterium in PTC patients following Iodine therapy
|
Genus |
Before Iodine therapy |
Two weeks after Iodine therapy |
Two months after Iodine therapy |
p-value |
|
Lactobacillus count |
2.42±2.09 |
3.80±2.00 |
5.27±2.73 |
0.014 |
|
Bifidobacterium count |
6.62±1.12 |
6.68±1.17 |
7.38±1.22 |
0.085 |
*copies/gr of stool; PTC: Papillary Thyroid Cancer.
Supplementary Table 1. Correlation between Bifidobacterium /Lactobacillus and TASH level
|
Bacteria |
PTC Group |
Status |
Spearman’s rho |
p-value |
|
Bifidobacterium
|
Before vs. after RIA |
2 weeks vs. baseline |
0.3333 |
0.2657 |
|
2 months vs. baseline |
0.3683 |
0.1004 |
||
|
2 months vs. 2 weeks |
0.0610 |
0.8099 |
||
|
Lactobacillus |
Before vs. after RIA |
2 weeks vs. baseline |
0.4772 |
0.0721 |
|
2 months vs. baseline |
-0.1274 |
0.6783 |
||
|
2 months vs. 2 weeks |
-0.0021 |
0.9935 |
PTC: Papillary Thyroid Cancer.
Correlation between TSH levels and Lactobacillus/Bifidobacterium
Also the correlation between Lactobacillus/Bifidobacterium and TSH level was evaluated. However, there was no meaning-full correlation between TSH level and neither Lactobacillus nor Bifidobacterium before and after iodine therapy (Supplementary table 1).
Adverse events
Most GI-related symptoms observed post iodine therapy were nausea (40%), diarrhea (20%), dry mouth (20%), and heartburn (6.67%), and vomiting (3.3%). However, there was no meaning-full correlation with the microbiota change.
Discussion
Recent evidence suggests a relationship between gut microbiota, such as Lactobacillus, and thyroid health (17). Specific strains of Lactobacillus may have immunomodulatory effects, potentially influencing the microenvironment of tumors (18,19). For instance, a study by Lu et al found that certain probiotics, including Lactobacillus, can help regulate immune responses and may play a role in decreasing the risk of thyroid cancer by modulating inflammatory pathways and promoting gut health (18).
Confirming the results of previous studies, the current study indicated a significant lower load of Lactobacillus in PTC patients compared to the healthy individuals. This difference disappeared after RAI therapy. Likewise, another study found a significantly lower relative abundance of Lactobacillus in thyroid cancer compared to the healthy controls (10). A more recent study showed a significant negative correlation between the abundance of Lactobacillus and tumor volume (20). Moreover, they found a significant reduction in the relative abundances of Lactobacillus in tumor tissues with Lymph Node Metastasis (LNM) compared to those without LNM (20).
On the other hand, RAI therapy has been shown to change the gut microbiota (4,21). A recent ex vivo experiment indicated 3.46-fold increase in the abundance of Lactobacillus in fecal samples exposed to I-131 (21). Although the results of an experimental study cannot be directly compared with those of clinical study, the present study similarly showed an increase in the abundance of Lactobacillus following RAI therapy. Another study also demonstrated different stages of RAI therapy exert various effects on gut microbiota (22). Moreover, there is also a bidirectional relationship between thyroid hormone level and microbacteria (R).
The alteration of microbiota following RAI therapy could be attributed to factors such as changes in dietary habits during treatment, the impact of radiation on gastrointestinal cells, and alteration in hormones due to thyroid ablation (22,23). These changes in the microbiota may affect patient outcomes, including recovery and quality of life, highlighting the need for further research to explore the mechanisms behind these associations and the potential for microbiota modulations as an adjuvant therapy in PTC management (4).
Bifidobacterium, another beneficial genus of gut microbiota, has been investigated for its potential influence on thyroid health and cancer (3,8). Evidence has shown that a balanced gut microbiome, including strains of Bifidobacterium, could help to prevent chronic inflammation and support overall immune function, potentially lowering the risk of thyroid cancer (8,24). However, direct studies on Bifidobacterium and PTC specifically are limited. The abundance of Bifidobacterium in PTC patients before and following RAT therapy was studied and compared to the healthy individuals. Nevertheless, no significant change was found in the Bifidobacterium load at different stages of RAI therapy between the two groups. Moreover, there was no significant change in the load of Bifidobacterium over the three timepoints.
Another study explored the alteration in the gut microbiota before and after the first and second episode of RAI therapy, found no significant difference in the abundance of Bifidobacterium before and after the second episode of RAI therapy, although Bifidobacterium was abundant after the first episode of RAI therapy (22). However, there is a complex interaction between gut microbiota, RAI therapy, and thyroid cancer. Although it is an evolving area of research, many factors (pollution, ethnicity, dietary habits, lifestyle, and drug intake) that exert a key role in shaping gastrointestinal microenvironment have not been taken into account in all studies.
Strengths and limitations
To our knowledge, this was the first study among a population of Iranian people to investigate alterations in the gut microbiota in patients with PTC at different time points following RAI therapy. This study included adequate number of PTC patients and healthy individuals for comparison. However, dietary habits and other environmental factors that may interact with gut microbiota were not taken into account in this study.
Conclusion
In conclusion, this study indicated a significant lower abundance of Lactobacillus in PTC patients compared to the healthy individuals; this difference disappeared following RAI therapy. Moreover, the load of Lactobacillus significantly increased over the time after RAI therapy in patients with PTC. However, this remains an observational association. We cannot definitively state that RAI therapy caused the increase in Lactobacillus. The recovery over time could coincidentally be related to other post-treatment changes like improving in thyroid function.
While the result points to a potential beneficial side effect of RAI, further research is essential to confirm causality, elucidate the underlying mechanisms, and determine the clinical significance of this microbial shift.
Funding
This study was funded by Iran University of Medical Sciences.
Ethics approval and consent to participate
This study was approved by the Ethics Committee at Iran University of Medical Sciences (Ethics Number: IR.IUMS.REC.1398.1413).
Acknowledgement
We thank all the participants enrolled in this study.
Conflict of Interest
All authors declare that they have no competing interests.